Menu

Фарш из курицы и свинины пропорции


Домашний фарш из свинины и курицы

Мне очень нравятся блюда из фарша. Котлеты, тефтели, рулеты, фаршированные овощи, запеканки, пельмени – все просто в приготовлении и очень вкусно. Самым лучшим для приготовления этих блюд будет, конечно, домашний фарш. Его можно приготовить из одного вида мяса или нескольких. Я очень часто готовлю домашний фарш из свинины и курицы. Пробовала разные сочетания и такое нравится больше всего. За счет добавления курицы фарш получается нежным и сочным, а за счет добавления свинины густым и ароматным. При измельчении мяса обязательно для сочности добавляю много репчатого лука, а для аромата чеснок. Такой смешанный фарш подходит для приготовления любых блюд, все они получатся очень ароматными и вкусными. Для измельчения беру кусок свинины без костей и целую курицу. Дам точные расчеты по весу филе, овощей и посчитаю сколько в итоге получается фарша.

Домашний фарш из свинины и курицы

Распечатать рецепт

Вкуснейший домашний фарш из целой курицы и свинины. Отлично подойдет для приготовления любых блюд. Пельмени, тефтели, котлеты, запеканки, рулеты и фаршированные овощи с таким фаршем получаются очень сочными и ароматными. Даю точный вес всех ингредиентов.

Домашний фарш из свинины и курицы

Распечатать рецепт

Вкуснейший домашний фарш из целой курицы и свинины. Отлично подойдет для приготовления любых блюд. Пельмени, тефтели, котлеты, запеканки, рулеты и фаршированные овощи с таким фаршем получаются очень сочными и ароматными. Даю точный вес всех ингредиентов.

Ингредиенты

Порции: 3,6 кг

Инструкции

  1. Пропорции свинины и курицы можно брать любые. Для приготовления фарша можно брать любую часть тушки свинины на костях или без них. У меня кусок свиного окорока без костей. Мясо нежирное. Если любите фарш пожирнее, то добавьте к мясу кусок сала. Свинину промываем и просушиваем бумажными полотенцами.

  2. Подготовленный кусок окорока нарезаем на средние куски.

  3. Целую курицу хорошо промываем внутри, снаружи и просушиваем бумажными полотенцами. Свинину берем нежирную, поэтому у курицы возьмем всю кожу и жир.

  4. Чтобы снять филе с костей, от куриной тушки отрезаем крылышки, ножки, бедра и грудку. Можно снять филе и с целой курицы, но это очень кропотливая работа. Мне проще снять филе с небольших частей.

  5. От курицы остается спинка, свисающая кожа и жир с нижней части и свисающая кожа на шеи.

  6. Кожу и жир со всех сторон подрезаем ножом. Просматриваем и, если не нравятся какие-то части, отрезаем и выкидываем. Спинку делим на 2 части и срезаем с них мясо и кожу.

  7. С крылышек, ножек, бедер и гудки срезаем аккуратно филе и нарезаем на крупные куски. В итоге филе со всей курицы (вес 1,7 кг) весит 1,1 кг.

  8. Обрезков и костей получается 600 гр. Кости, конечно, не выбрасываем. Складываем их в пакет, замораживаем и по мере необходимости готовим из них вкуснейший бульон.

  9. Зубчики чеснока очищаем. Слишком много чеснока не добавляем, иначе будет перебивать вкус мяса. Лук очищаем и нарезаем на средние ломтики. Лук добавит фаршу приятный вкус и сочность.

  10. Все продукты подготовлены и теперь приступаем к их измельчению. Пропускаем все через мясорубку, хорошо перемешиваем и вкуснейший домашний фарш готов. По времени тратим не больше 30 минут и в итоге получим ароматные и вкусные блюда.

  11. В итоге получается 3,6 кг смешанного фарша. Фарш можно сразу весь посолить, поперчить. Из него можно сразу сделать котлеты, тефтели, пельмени, манты или хинкали и заморозить. Фарш можно разделить на порции, заложить в пакеты, заморозить и вынимать по мере необходимости. Приятного аппетита!!!

Фарш из свинины по-китайски с лапшой («китайский болоньезе»)

Ласково называемый «китайским болоньезе», настоящее название этой вкусной и сверхбыстрой китайской свинины с лапшой - «За Цзян Мянь». Соус имеет классический китайский вкус - пикантный с оттенком сладкого и легким перцем чили (или даже больше, если хотите!). Один укус, и ты станешь таким же зависимым, как и я!

Я ел это только на завтрак.

Действительно. Утро среды. Сидней «страдает» от сильной жары (35C / 95F).И пока нормальные люди едят на завтрак холодный полезный смузи или тарелку свежих фруктов с йогуртом, я разогрел тарелку горячей острой китайской лапши.

Это мое японское воспитание !! В Японии хлопья и тосты практически не используются на завтрак, за исключением отелей, обслуживающих западных туристов. Традиционные завтраки в Японии даже сегодня в большинстве домашних хозяйств (по крайней мере, у моих родственников) похожи на мини-ужин. Почти всегда с протеином - довольно часто с рыбой.

Это праздничный снимок типичного завтрака, который нам подают в Японии, когда мы останавливаемся у родственников. Это похоже на обеденный намаз! Рыба, клейкий рис, темпура, салат, мисо-суп…

(Да, это низкий столик, за которым мы сидим на полу 🙂)

(Да, это прозрачная пластиковая крышка на столе. Все вместе говорят: «Это оооочень азиатский !»)

До этой минуты я не мог решить, присоединюсь ли я к своей семье в поездке в Японию в следующем месяце. Я точно пойду! Мне нужна моя японская еда! (Эээ, да, и, конечно, провести время с родственниками) (И на лыжах 😉)

Здесь не в порядке - я сегодня даже не делюсь японским блюдом (моя мама теперь управляет этим доменом в своем блоге RecipeTin JAPAN). Я просто пытался объяснить / оправдать, почему у меня на завтрак была острая китайская лапша. Во время жары не меньше. ?

Эта китайская свинина с лапшой ласково известна как «китайский болоньезе». А по фотографиям понятно, почему.Но вкус не мог быть другим! Хотя ваши глаза могут видеть блюдо типа спагетти, в ту минуту, когда вы откусываете, оно становится китайским насквозь. Это не выглядит таким дерзким, как болоньезе, но свинина имеет более ароматный вкус, который смешивается с лапшой, когда вы копаетесь.

В этом рецепте китайской свиной фарши и лапши есть несколько ингредиентов, которые нужно покупать в азиатских продуктовых магазинах. Быть соусом из фасоли чили (вверху на фото ниже) и сладким соусом (нижняя банка).Которые, как следует из названия, острые и сладкие. 🙂

Однако не отчаивайтесь, если вы не можете их найти! Эти соусы великолепны, потому что они имеют сложный вкус, поэтому они вам просто необходимы, но есть легкие замены с использованием ингредиентов, которые вы можете купить в супермаркетах здесь, в Австралии. Я сделал небольшую порцию на обед, используя ВСЕ замены (чего я никогда раньше не делал, обычно я заменяю одну или две, но не все!), И, честно говоря, я не удивлюсь, если некоторые люди действительно предпочтут сделанную версию используя замены!

PS Я также включил их в видео с рецептами ниже, чтобы вы лучше видели консистенцию.

Соус чили, поданный с этим, является довольно важной частью общего впечатления. Китайский соус чили - это не только перец чили, но и другие ароматизаторы. Это бренд, который я использую - я рекомендовал к нему многих друзей. Его рекомендовал мне один азиатский продуктовый магазин, и это лучшее, что я когда-либо пробовала. Используйте его для всего и всего, что хотите, чтобы добавить острого перца чили (ну, по крайней мере, чего-нибудь азиатского!). Он отлично подходит для макания соусов, ложки и добавления в жаркое.

Но если вы не можете найти тот или другой азиатский соус чили, не волнуйтесь, в рецепте для вас есть несколько замен!

Австралия! Я знаю, что мы в разгаре лета ... но знаете что? Большая часть Азии всегда в волне тепла. А вы когда-нибудь замечали, что чем жарче климат, тем острее еда? Южная Америка, Африка, Карибский бассейн, креольский язык и, конечно же, Азия! Есть теория, что острая еда помогает нам сохранять хладнокровие. Будь то потому, что от него потеет, который затем кажется прохладным, когда он испаряется (неприятный разговор, я знаю!), Или это тоже связано с наукой - нервы на нашем языке, которые определяют острую пищу и заставляют наш организм реагировать охлаждением.

Тем не менее, я никогда не позволял погоде диктовать, что мне есть. Принесите лето и острую пищу !!!! - Наги х

БОЛЬШЕ БЫСТРЫХ РЕЦЕПТОВ ИЗ СВИНИНЫ / СВИНОГО фарша

PS Вот как это есть: подавайте как олдскульный болоньезе со свининой поверх лапши. Затем все перемешайте. Чтобы улучшить впечатления - потому что это действительно сложно, даже для меня, кому удобнее пользоваться палочками для еды, чем ножом и вилкой, - используйте ложку, чтобы получить полный рот свинины И лапши!

Хотите большего? Подпишитесь на мою рассылку и следите за всеми последними обновлениями в Facebook, Pinterest и Instagram.

Свинина по-китайски с лапшой («Китайская болоньезе»)

Автор: Nagi | Рецепт Олово ест

Подготовка: 10 мин.

Готовка: 10 минут

Всего: 20 минут

Ужин

Китайский

Порций3 - 4

Нажмите или наведите указатель мыши для масштабирования

Не пугайтесь азиатских специальных соусов, это один из тех рецептов, который все еще отлично работает с заменами.Некоторые люди могут даже предпочесть, чтобы это было сделано с сабвуферами! . Настоящее название этой жареной свинины с лапшой - лапша «Чжа Цзян Мянь», которую также ласково называют «китайский болоньезе». Фарш из свинины или фарша обжаривается с классическим китайским вкусом, пряным и сладким. Рецепт видео ниже рецепта.

Инструкции

  • Смешайте ингредиенты соуса.

  • Приготовьте лапшу в соответствии с указаниями на упаковке.Если он говорит, что лапшу нужно замочить, вы можете сделать это во время жарки.

  • Дополнительно: Непосредственно перед подачей на стол перемешайте лапшу с маслом и уксусом. *

  • Нагрейте масло в воке или сковороде на среднем огне. Добавить лук и варить 1 минуту. Добавьте чеснок и имбирь и готовьте 1 минуту, пока лук не станет полупрозрачным.

  • Добавьте свинину и готовьте, измельчая по ходу дела, пока не подрумянится.

  • Добавьте соус и готовьте в течение 3–5 минут или пока большая часть соуса не уменьшится.

  • Разложите лапшу по мискам. Сверху посыпьте свининой, кориандром и свежими огурцами.

  • Чтобы поесть, смешайте лапшу и свинину. Я использую палочки для еды и ложку - так легче получить свинину и лапшу одним глотком. Не отказывайтесь от пасты чили! Прекрасно сочетается с этим блюдом!

Примечания к рецепту:

* Эти ингредиенты не являются обязательными. Они не используются в традиционных китайских рецептах Чжа Цзян Мянь, но они используются в рецептах ресторана, которые я использовал (см. Ниже для справки), и мне действительно нравится крошечный оттенок кислого, который он привносит в это блюдо.1. Это блюдо лучше всего готовить из лапши МУКА (белая), а не из яичной (желтой) или рисовой лапши. Я считаю, что лучшая лапша для этого блюда - это свежая белая лапша из азиатских продуктовых магазинов или даже лапша Удон из супермаркетов. Мне нравится использовать лапшу, которая похожа на толстую форму спагетти, но вы определенно можете использовать плоскую. Хотя это традиционно делается из мучной лапши, вы определенно можете приготовить ее с другой лапшой на выбор! Я знаю, что 800 г лапши - это много, и это так! Но лапша из свежей муки очень плотная и тяжелая, примерно в два раза больше, чем, например, лапша чау-мейн.2. Китайский черный уксус, уксус Chinkiang, на самом деле имеет довольно похожий вкус на бальзамический уксус. Так что можно заменить бальзамиком. 3. Соус из фасоли чили - см. Фото в посте, продается в азиатских продуктовых магазинах. Также известный как Doubanjiang, он сделан из соевых бобов, перца чили и других ароматизаторов. Его можно заменить 2 чайными ложками мисо + 2 чайными ложками шрирача или другой острой пасты из перца чили. 4. Китайский сладкий бобовый соус (см. Фото в посте) также делают из соевых бобов, но он скорее сладкий, чем острый.Хойсин на самом деле очень похож, поэтому, если вы не можете найти сладкий бобовый соус в азиатском магазине, просто используйте хойсин. 5. Темный соевый соус темнее по цвету, чем универсальный светлый соевый соус, и имеет более сильный аромат. Я настоятельно рекомендую вам найти для этого рецепта темный соевый соус. Сейчас в Австралии его продают в азиатском разделе крупных супермаркетов. 6. См. Фото моей любимой китайской пасты с перцем чили, Xianglawang. Мне рекомендовал его азиатский продуктовый магазин, он сделан не только из перца чили.Однако в свинине достаточно аромата, поэтому для этого можно использовать практически любой соус чили, даже западный острый соус. Не сдерживайся! Это оооочень фантастично, когда заряжен чили! Однако, если вы действительно хотите приготовить это с азиатским соусом чили, используйте соус чили в этом безупречном рецепте вареной куриной грудки. Это простая домашняя версия китайского соуса чили. 7. Заимствовано из этого рецепта китайским рестораном уличной еды в Мельбурне, Австралия, под названием Lawyers, Guns and Money from Gourmet Traveler. 8. Китайский свиной фарш с питательной лапшой на порцию, исключая соус чили, но включая огурцы.

Информация о питании:

Порция: 470 г Калории: 475 ккал (24%) Углеводы: 53,2 г (18%) Белки: 35,5 г (71%) Жиры: 13,2 г (20%) Насыщенные жиры: 3,1 г (19%) Полиненасыщенные жиры : 10,1 г Холестерин: 123 мг (41%) Натрий: 518 мг (23%) Клетчатка: 3 г (13%) Сахар: 5,5 г (6%)

Вы приготовили этот рецепт? Мне нравится слышать, как вы применили мои рецепты! Отметьте меня в Instagram на @RecipeTinEats.

ПОСМОТРЕТЬ, КАК СДЕЛАТЬ


СРОК СЛУЖБЫ БУЛЬДОЗЕРА

Он меня прекрасно слышит. Как и у большинства мужчин, у него избирательный слух. Особенно в такие жаркие дни, как сегодня!

.

Количественный анализ продуктов из свинины и курицы с помощью цифровой капельной ПЦР

В этом проекте был разработан высокоточный количественный метод, основанный на методе цифровой полимеразной цепной реакции (дПЦР), для определения веса свинины и курицы в мясных продуктах. Количественная полимеразная цепная реакция в реальном времени (КПЦР) в настоящее время используется для количественного молекулярного анализа присутствия видоспецифичных ДНК в мясных продуктах. Однако он ограничен в эффективности амплификации и основан на стандартных кривых, основанных на значениях Ct, обнаружении и количественной оценке ДНК-мишени с низким числом копий, как в некоторых сложных мясных продуктах.Используя метод цПЦР, мы обнаружили, что отношения между массой сырого мяса и массой ДНК, а также между массой ДНК и числом копий ДНК были близки к линейным. Это позволило нам разработать формулы для расчета веса сырого мяса на основе количества копий ДНК. Точность и применимость этого метода были проверены и проверены с использованием образцов порошка из свинины и курицы, смешанных в известных пропорциях. Количественный анализ показал, что цПЦР обеспечивает высокую точность количественного определения свинины и курицы в мясных продуктах и, следовательно, может использоваться в рутинном анализе государственными регулирующими органами и отделами контроля качества коммерческих предприятий по производству пищевых продуктов и кормов.

1. Введение

В 2013 году скандал с фальсификацией конины [1, 2] прокатился по Европе, региону, который, как считается, придерживается самых высоких мировых стандартов безопасности пищевых продуктов. В ходе этого скандала было обнаружено, что мясные продукты, рекламируемые как содержащие говядину, содержат необъявленное мясо, такое как конина. В некоторых случаях до 100% мяса составляло другое необъявленное мясо. Из-за схожей текстуры и технологий обработки различных мясных продуктов потребителям сложно определить их подлинность, не говоря уже о точной пропорции мяса в данном продукте.Искушение огромной прибыли и быстрой выгоды сделало фальсификацию мясных продуктов постоянной проблемой, когда высококачественные мясные продукты заменяются более дешевыми и низкокачественными аналогами; поэтому государственные или правительственные программы контроля качества несут ответственность за обеспечение безопасности мясных продуктов. Тем не менее, для облегчения этой задачи необходимо исследовать и разработать надежные качественные и количественные методы обнаружения.

По сравнению с обычной полимеразной цепной реакцией (ПЦР) [3, 4], которая широко использовалась в качестве качественного метода для определения наличия видоспецифических целевых ДНК в образцах пищевых продуктов и кормов, полимеразная цепная реакция в реальном времени (qPCR) [ 5, 6] имеет преимущество не только в обнаружении, но и в количественной оценке взаимосвязи между пороговыми значениями цикла () и исходной концентрацией матрицы ДНК.Тем не менее, технология qPCR по-прежнему имеет несколько проблем [7, 8], которые напрямую влияют на точность количественного анализа, включая эффективность амплификации ПЦР, использование стандартных кривых, основанных на значениях, высокий фон, создаваемый нецелевыми образцами ДНК, и проблемы с подбор подходящего справочного материала.

Цифровая ПЦР (dPCR) - это новый метод точного количественного определения нуклеиновых кислот [9, 10], который использует анализ предельного разведения и анализ распределения Пуассона, чтобы обеспечить абсолютное количественное определение количества копий целевой ДНК [11].Цифровая ПЦР использует ту же систему реакции амплификации, что и стандартная система количественной ПЦР. Генератор капель используется для разделения каждой реакционной смеси dPCR на капли размером 20 000 нанолитров. Каждая капля содержит ноль (отрицательная), одна или несколько копий целевой ДНК (положительная). После обычной процедуры ПЦР общее количество отдельных капель с положительным или отрицательным шаблоном подсчитывается и регистрируется устройством для считывания капель. Наконец, исходное абсолютное число копий целевой ДНК (копий / мкл л) образцов можно напрямую рассчитать, следуя закону распределения Пуассона.

В качестве усовершенствования традиционной кПЦР, цПЦР может позволить более точное и чувствительное измерение количества копий целевой ДНК, особенно для образцов с низкой концентрацией, образцов с высоким уровнем фона и составных образцов. В результате, цПЦР применялась в широком диапазоне областей, включая количественный анализ экспрессии генов [12], анализ однонуклеотидного полиморфизма [13], генотипирование [14], обнаружение редких вариантов и вариаций числа копий, обнаружение патогенов [15], исследование лекарственной устойчивости [16] и исследование некодирующей РНК [17].

Здесь мы представляем систему измерения веса мясных продуктов, основанную на технологии цПЦР, для точного обнаружения и количественного определения конкретных нуклеиновых кислот в курице или свинине. Используя эту простую процедуру амплификации и расчета, можно точно количественно определить вес мяса в образце. Это первый раз, когда метод цПЦР был использован для количественной оценки мясных продуктов.

2. Материалы и методы
2.1. Приготовление образца мяса

Свежее постное мясо и имеющиеся в продаже продукты были приобретены в местном супермаркете.Свежую свинину ( Sus scrofa ), курицу ( Gallus gallus ) и товарные продукты измельчали ​​отдельно, сушили в печи для выпечки (UFE500AO; Memeert, Германия) при 80 ° C в течение 72 ч, а затем измельчали ​​до сверхтонкого порошок в жидком азоте с помощью морозильного смесителя (морозильная камера / мельница 6850; SPEX SamplePrep, США). Смешанные образцы свинины и курицы с известным составом (от 90% до 10%) были использованы для проверки достоверности и чувствительности метода. Чтобы гарантировать, что экстрагированная ДНК точно отражает пропорции различных видов мяса, для равномерного измельчения смесей для обеспечения полного перемешивания использовался морозильный миксер.Для проверки применимости этого метода были использованы коммерчески доступные продукты.

2.2. Экстракция ДНК

Для всех образцов геномную ДНК экстрагировали из 100 мг порошка фенол / хлороформным методом [19]. Вкратце, 800 мкл мкл буфера для лизиса гистиоцитов (Tiangen, Китай) с 100 мкл мкг протеиназы K (Tiangen, Китай) добавляли к каждому образцу, встряхивали и инкубировали при 65 ° C в течение 60 мин с периодическим энергичным встряхиванием. ; добавляли равный объем фенола / хлороформа, перемешивали и центрифугировали при 12000 об / мин в течение 10 мин.Водный (верхний) слой переносили в чистую пробирку; добавляли равный объем хлороформа, перемешивали и затем центрифугировали в течение 5 мин при 12000 об / мин. Водный (верхний) слой переносили в чистую пробирку; добавляли одну десятую объема 3 М ацетата Na (pH 5,2) и два объема ледяного EtOH (100%), смешивали и инкубировали при -20 ° C в течение 30 минут, а затем центрифугировали при 12000 об / мин в течение 30 минут. при 4 ° C. Супернатант удаляли, осадок ДНК дважды промывали 75% EtOH и центрифугировали при 12000 об / мин в течение 2 минут при 4 ° C; супернатант удаляли, а осадок сушили на воздухе в течение 30 мин при комнатной температуре, ресуспендировали в 100 мкл л ddH 2 O и хранили при -20 ° C.

2.3. Праймеры и зонды

Для обнаружения свинины и курицы используется ген Sus Scrofa бета-актина ( ACTB ) (номер доступа в GenBank: DQ452569) [20] и Gallus gallus , трансформирующий фактор роста бета-3 ( TGFB3 ). ) (регистрационный номер GenBank: AY685072) [18] были выбраны в качестве последовательностей обнаружения мишеней, соответственно, как описано ранее [21–23]. Онлайн-инструменты, поддерживаемые NCBI, использовались для поиска и выравнивания последовательностей. Праймеры и зонды были разработаны с использованием программного обеспечения Primer Express версии 3.0 поддерживается Applied Biosystems (ABI, Фостер-Сити, Калифорния, США). Все выбранные праймеры и зонды прошли оценку специфичности и гомологии с помощью поиска BLAST по всей базе данных GenBank. Нуклеотидные последовательности праймеров и зондов, используемых в этом исследовании, были разработаны с учетом оптимальных условий для dPCR [24]. Для обнаружения свинины использовали зонд, меченный флуорофором VIC (ABI, Фостер-Сити, Калифорния, США) и гасителем для связывания малых канавок (MGB). Для обнаружения цыплят использовали флуорофор FAM и гаситель черной дыры (BHQ) (таблица 1).

GAGTC-MGB GAGTC-MGB Gall
129bp-F - CAMGC62 Gallus-TGAGTG

Праймер / зонд Последовательность / маркировка Регистрационный номер GenBank

Sus-ACTB-97bp-F CGTAGGTGCACACAGTAGGTC ген
Sus-ACTB-97bp-R GGCCAGACTGGGGACATG DQ452569
Sus-ACTB-97bp-P VIC-CCAGGTCGGGGAGTC-MGB
GGCTGCAAGTCACCGTGGTA Ген TGFB3
Gallus-TGFB3-129bp-R CCGCTAGCCAGAAGCTCAGC AY685072
Gallus-TGAGTGAC

2.4. Специфичность

Чтобы проверить специфичность системы цПЦР (включая праймеры и зонды), ДНК из широкого диапазона образцов животных была выделена и протестирована с помощью системы цПЦР.

2.5. Процедура цифровой ПЦР

Каждые 20 мкл л реакционной смеси готовили следующим образом: 1,8 мкл л каждого праймера (конечная концентрация 900 нМ), 0,5 мкл зонда л (конечная концентрация 250 нМ) и 10 Смешивали мкл л основной смеси ddPCR (Bio-Rad, Геркулес, Калифорния, США), а затем 4 мкл мкл (40-кратное разведение исходного образца для экстракции ДНК) матричной ДНК и 1.Добавляли 9 мкл л воды, свободной от нуклеаз и протеаз (ThermoScientific, Солт-Лейк-Сити, Юта, США). Генератор капель ддПЦР Bio-Rad QX100 (Bio-Rad) использовали для разделения смеси из 20 мкл л приблизительно на 20000 капель, при этом целевые сегменты ДНК и реагенты для ПЦР случайным образом распределялись по каплям. Обычную ПЦР выполняли с использованием термоциклера T100 (Bio-Rad) в соответствии со следующим протоколом циклов: активация фермента в течение 10 минут при 95 ° C с последующими 40 циклами 30-секундной денатурации при 94 ° C; Отжиг в течение 1 мин и удлинение при 60 ° C с последующей инактивацией ферментов при 98 ° C в течение 10 мин и выдержкой при 4 ° C (в соответствии с инструкциями производителя).После ПЦР-амплификации устройство для чтения капель определяет, какие капли содержат целевой ампликон ДНК, а какие нет. Затем программное обеспечение рассчитывает концентрацию целевой ДНК в копиях на микролитр из фракции положительных реактивов

.

Пищевая ценность и влияние на здоровье

Свинина - это мясо домашней свиньи ( Sus domesticus ).

Это красное мясо, которое чаще всего употребляют во всем мире, особенно в Восточной Азии, но его потребление запрещено некоторыми религиями, такими как ислам и иудаизм.

По этой причине свинина запрещена во многих исламских странах.

Его часто едят в необработанном виде, но также очень распространены вяленые (консервированные) продукты из свинины. К ним относятся копченая свинина, ветчина, бекон и сосиски.

Нежирная свинина, богатая белками и витаминами и минералами, может стать отличным дополнением к здоровому питанию.

В этой статье рассказывается все, что вам нужно знать о свинине.

Свинина - это продукт с высоким содержанием белка и различным количеством жира.

Порция вареного свинины массой 3,5 унции (100 грамм) содержит следующие питательные вещества (1):

  • Калорийность: 297
  • Вода: 53%
  • Белок: 25.7 грамм
  • Углеводы: 0 грамм
  • Сахар: 0 грамм
  • Клетчатка: 0 грамм
  • Жир: 20,8 грамма

Свиной белок

Как и все мясо, свинина в основном состоит из готовой продукции белка.

Содержание белка в нежирной вареной свинине составляет около 26% от веса свежей.

В сухом виде содержание белка в нежирной свинине может достигать 89%, что делает ее одним из самых богатых диетических источников белка (1).

Он содержит все девять незаменимых аминокислот, необходимых для роста и поддержания вашего организма.Фактически, мясо является одним из наиболее полноценных диетических источников белка.

По этой причине употребление в пищу свинины или других видов мяса может быть особенно полезно для бодибилдеров, выздоравливающих спортсменов, людей, перенесших операцию, или других людей, которым необходимо нарастить или восстановить мышцы.

Свинина

Свинина содержит разное количество жира.

Доля жира в свинине обычно колеблется в пределах 10–16% (2), но может быть намного выше в зависимости от уровня обрезки и других факторов.

Осветленный свиной жир, называемый сало, иногда используется в качестве кулинарного жира.

Как и другие виды красного мяса, свинина в основном состоит из насыщенных и ненасыщенных жиров, присутствующих примерно в равных количествах.

Например, порция приготовленного свинины на 3,5 унции (100 грамм) содержит около 7,7 грамма насыщенных, 9,3 грамма мононенасыщенных и 1,9 грамма полиненасыщенных жиров (1).

По составу жирных кислот свинина немного отличается от мяса жвачных животных, таких как говядина и баранина.

В нем мало конъюгированной линолевой кислоты (КЛК) и немного больше ненасыщенных жиров (3).

РЕЗЮМЕ

Высококачественный белок является основным питательным компонентом свинины, что делает его полезным для роста и поддержания мышц. Жирность свинины разная. В основном он состоит из насыщенных и мононенасыщенных жиров.

Свинина - богатый источник многих витаминов и минералов, в том числе:

  • Тиамин. В отличие от других видов красного мяса, таких как говядина и баранина, свинина особенно богата тиамином - одним из витаминов группы B, который играет важную роль в различных функциях организма (4).
  • Селен. Свинина богата селеном. Лучшими источниками этого важного минерала являются продукты животного происхождения, такие как мясо, морепродукты, яйца и молочные продукты (5).
  • Цинк. Цинк, важный минерал, богатый свининой, необходим для здоровья мозга и иммунной системы.
  • Витамин B12. Витамин B12, почти исключительно содержащийся в продуктах животного происхождения, важен для кроветворения и работы мозга. Дефицит этого витамина может вызвать анемию и повреждение нейронов.
  • Витамин B6. Витамин B6, состоящий из нескольких родственных витаминов, важен для образования красных кровяных телец.
  • Ниацин. Один из витаминов группы B, ниацин, или витамин B3, выполняет множество функций в организме и важен для роста и обмена веществ.
  • Фосфор. Фосфор, содержащийся в большом количестве и часто встречающийся в большинстве пищевых продуктов, обычно является важным компонентом рациона людей. Это важно для роста и поддержания тела.
  • Утюг. Свинина содержит меньше железа, чем баранина или говядина. Тем не менее, усвоение мясного железа (гемового железа) из пищеварительного тракта очень эффективно, а свинина может считаться выдающимся источником железа.

Свинина содержит большое количество многих других витаминов и минералов.

Кроме того, обработанные и вяленые продукты из свинины, такие как ветчина и бекон, содержат большое количество соли (натрия).

РЕЗЮМЕ

Свинина - отличный источник многих витаминов и минералов, включая тиамин, цинк, витамин B12, витамин B6, ниацин, фосфор и железо.

Как и растения, продукты животного происхождения содержат ряд биологически активных веществ, помимо витаминов и минералов, которые могут повлиять на здоровье:

  • Креатин. Креатин в большом количестве содержится в мясе и является источником энергии для ваших мышц. Это популярная среди бодибилдеров добавка, рекомендованная для улучшения роста и поддержания мышц (6, 7).
  • Таурин. Таурин, содержащийся в рыбе и мясе, является аминокислотой-антиоксидантом, вырабатываемой вашим организмом. Потребление таурина с пищей может быть полезно для работы сердца и мышц (8, 9, 10).
  • Глутатион. Это антиоксидант, который в больших количествах присутствует в мясе, но также вырабатывается вашим организмом. Хотя это важный антиоксидант, роль глутатиона как питательного вещества неясна (11, 12).
  • Холестерин. Стерол, содержащийся в мясе и других продуктах животного происхождения, таких как молочные продукты и яйца. Умеренное потребление холестерина не влияет на уровень холестерина у большинства людей (13).
РЕЗЮМЕ

Свинина содержит ряд биоактивных мясных соединений, таких как креатин, таурин и глутатион, которые могут принести пользу здоровью различными способами.

Свинина богата различными полезными витаминами и минералами, а также высококачественным белком. Правильно приготовленная свинина может стать отличным элементом здорового питания.

Поддержание мышечной массы

Как и большинство продуктов животного происхождения, свинина является отличным источником высококачественного белка.

С возрастом сохранение мышечной массы становится важным фактором для здоровья.

Без упражнений и правильной диеты мышечная масса естественным образом деградирует с возрастом - неблагоприятное изменение, которое связано со многими возрастными проблемами со здоровьем.

В наиболее тяжелых случаях истощение мышц приводит к состоянию, называемому саркопенией, которое характеризуется очень низким уровнем мышечной массы и снижением качества жизни. Саркопения чаще всего встречается у пожилых людей.

Недостаточное потребление высококачественного белка может ускорить возрастную дегенерацию мышц, увеличивая риск саркопении (14).

Употребление свинины или других продуктов, богатых белком, является отличным способом обеспечить достаточное потребление высококачественного белка с пищей, который может помочь сохранить мышечную массу.

Повышение эффективности упражнений

Употребление мяса не только полезно для поддержания мышечной массы, но также может улучшить функцию мышц и физическую работоспособность.

Свинина не только богата высококачественным белком, но и содержит множество полезных питательных веществ, которые полезны для ваших мышц. К ним относятся таурин, креатин и бета-аланин.

Бета-аланин - это аминокислота, которую ваше тело использует для производства карнозина, который важен для работы мышц (15, 16).

Фактически, высокий уровень карнозина в мышцах человека был связан с уменьшением утомляемости и улучшением физической работоспособности (17, 18, 19, 20).

Соблюдение вегетарианской или веганской диеты с низким содержанием бета-аланина со временем снижает количество карнозина в мышцах (21).

Напротив, высокое потребление бета-аланина с пищей, в том числе из добавок, увеличивает уровень карнозина в мышцах (15, 17, 22, 23).

В результате употребление в пищу свинины или других источников бета-аланина может быть полезным для тех, кто хочет максимизировать свою физическую работоспособность.

РЕЗЮМЕ

Свинина - отличный источник высококачественного белка, поэтому она должна быть эффективной для роста и поддержания мышечной массы. Как и другие виды мяса, оно также может помочь улучшить мышечную функцию и повысить производительность.

Болезни сердца являются основной причиной преждевременной смерти во всем мире.

Сюда входят такие неблагоприятные состояния, как сердечные приступы, инсульты и высокое кровяное давление.

Наблюдательные исследования красного мяса и болезней сердца дали смешанные результаты.

Некоторые исследования показывают повышенный риск как для обработанного, так и для необработанного красного мяса, многие - только для обработанного мяса, в то время как другие не обнаружили какой-либо значимой связи (24, 25, 26, 27).

Нет четких доказательств того, что мясо само по себе вызывает сердечные заболевания. Наблюдательные исследования только выявляют ассоциации, но не могут предоставить доказательства прямой причинно-следственной связи.

Очевидно, что высокое потребление мяса связано с факторами нездорового образа жизни, такими как низкое потребление фруктов и овощей, меньшая физическая активность, курение и переедание (28, 29, 30).

Большинство обсервационных исследований пытаются исправить эти факторы.

Одна популярная гипотеза связывает содержание холестерина и насыщенных жиров в мясе с повышенным риском сердечных заболеваний.

Однако пищевой холестерин практически не влияет на уровень холестерина у большинства людей, и многие ученые не считают это проблемой для здоровья (13).

Связь между насыщенными жирами и сердечными заболеваниями спорна, и некоторые ученые начали преуменьшать ее роль в сердечных заболеваниях (31, 32, 33).

РЕЗЮМЕ

Умеренное употребление нежирной свинины как часть здорового питания вряд ли увеличит риск сердечных заболеваний.

Рак - серьезное заболевание, характеризующееся неконтролируемым ростом клеток в организме.

Многие обсервационные исследования отмечают связь между красным мясом и риском рака толстой кишки, хотя доказательства не совсем согласуются (34, 35, 36, 37, 38).

Трудно доказать, что свинина вызывает рак у людей, поскольку обсервационные исследования не могут предоставить доказательства прямой причинно-следственной связи.

Тем не менее, идея о том, что высокое потребление мяса вызывает рак, вполне правдоподобна. Особенно это касается мяса, приготовленного на сильном огне.

Переваренное мясо может содержать ряд канцерогенных веществ, в первую очередь гетероциклических аминов (39).

Гетероциклические амины - это семейство нездоровых веществ, которые в относительно больших количествах содержатся в хорошо прожаренном и пережаренном мясе, рыбе или других источниках животного белка.

Они образуются, когда животный белок, такой как свинина, подвергается воздействию очень высоких температур во время приготовления на гриле, барбекю, запекания или жарки (40, 41).

Исследования показывают, что продукты с высоким содержанием гетероциклических аминов повышают риск нескольких типов рака, таких как рак толстой кишки, груди и простаты (42, 43, 44, 45, 46).

Несмотря на эти доказательства, роль потребления мяса в развитии рака все еще неясна.

В контексте здорового питания умеренное потребление правильно приготовленной свинины, вероятно, не увеличивает риск рака. Тем не менее, для оптимального здоровья кажется разумным ограничить потребление пережаренной свинины.

РЕЗЮМЕ

Сама по себе свинина, скорее всего, не является фактором риска развития рака. Однако повод для беспокойства вызывает высокое потребление пережаренной свинины.

Следует избегать употребления сырой или недоваренной (редкой) свинины, особенно в развивающихся странах.

Это потому, что сырая свинина может содержать несколько типов паразитов, которые могут заразить людей (47).

Свиной цепень

Свиной цепень ( Taenia solium ) является кишечным паразитом.Иногда он достигает длины 6,5–10 футов (2–3 метра).

Инфекция в развитых странах встречается очень редко. Это вызывает большую озабоченность в Африке, Азии, Центральной и Южной Америке (47, 48, 49).

Люди заражаются, употребляя в пищу сырую или недоваренную свинину.

В большинстве случаев он совершенно безвреден и не вызывает симптомов.

Тем не менее, это может иногда приводить к заболеванию, известному как цистицеркоз, от которого ежегодно страдают около 50 миллионов человек (47).

Один из самых серьезных симптомов цистицеркоза - эпилепсия. Фактически, цистицеркоз считается основной причиной приобретенной эпилепсии (50).

Паразитические круглые черви

Trichinella - это семейство паразитических круглых червей, вызывающих заболевание, известное как трихинеллез или трихинеллез.

Хотя это заболевание встречается нечасто в развитых странах, употребление в пищу сырой или недоваренной (редко) свинины может увеличить ваш риск, особенно если мясо от свиней, выращиваемых на свободном выгуле, диких или домашних свиней (47).

Чаще всего трихинеллез имеет очень легкие симптомы, такие как диарея, боль в животе, тошнота и изжога, или вообще не имеет симптомов.

Тем не менее, это может перерасти в серьезное заболевание, особенно у пожилых людей.

В некоторых случаях это может привести к слабости, мышечной боли, лихорадке и отеку вокруг глаз. Это может даже привести к летальному исходу (51).

Токсоплазмоз

Toxoplasma gondii - это научное название паразитического простейшего животного - одноклеточного животного, видимого только в микроскоп.

Он обнаружен во всем мире и, по оценкам, присутствует примерно у одной трети всех людей (47).

В развитых странах, таких как США, наиболее частой причиной инфекции является потребление сырой или недоваренной свинины (52, 53, 54).

Обычно заражение Toxoplasma gondii не вызывает симптомов, но может привести к состоянию, известному как токсоплазмоз, у людей со слабой иммунной системой.

Симптомы токсоплазмоза обычно легкие, но они могут быть вредными для будущего ребенка и опасными для жизни у людей со слабой иммунной системой (47, 55).

Хотя паразиты, переносимые свининой, не распространены в развитых странах, свинину всегда следует есть, если она хорошо прожарена.

РЕЗЮМЕ

Из-за возможного заражения паразитами следует избегать употребления сырой или недоваренной свинины.

Свинина - самый популярный в мире вид мяса.

Это богатый источник высококачественного белка, а также различных витаминов и минералов.

Следовательно, он может улучшить физическую работоспособность и способствовать росту и поддержанию мышечной массы.

С другой стороны, следует избегать употребления как недоваренной, так и пережаренной свинины.

Переваренная свинина может содержать канцерогенные вещества, а недоваренная (или сырая) свинина может содержать паразитов.

Хотя это не совсем здоровая пища, умеренное потребление правильно приготовленной свинины может быть приемлемой частью здорового питания.

.

Яйцо на пару со свиным фаршем по-китайски

«Предыдущее сообщение Следующая запись »

Яйцо на пару со свиным фаршем по-китайски

Размещено wiffy в 1 июля 2009 г.

Не пропустите рецепт!
Получайте обновления рецептов на свой электронный ящик:

Яйцо на пару со свиным фаршем Рецепт

Используйте широкую и неглубокую посуду для приготовления этого блюда на пару, чтобы яйцо и свинина были приготовлены и распределены равномерно.

Обслуживает: 2-4

Время на подготовку: 15 минут

Время приготовления: 15 минут

Состав:

  • 150 г фарша из свинины (курицы)
  • 1/2 чайной ложки растительного масла
  • 1 столовая ложка мелко нарезанной моркови сложите тонкие ломтики моркови (нарезанной овощечисткой) перед нарезкой
(A) Смесь яичного крема
  • 2 яйца слегка взбитые
  • 3/4 стакана воды или прозрачного бульона
  • 1/2 чайной ложки вина Шаосин
  • 1/2 ч. Л. Легкого соевого соуса по вкусу; для заправки яичной смеси исключить при использовании жирного бульона
(B) Маринад
  • 1/2 чайной ложки легкого соевого соуса
  • 1/2 чайной ложки кунжутного масла
  • 1/2 чайной ложки вина Шаосин
  • несколько штрихов китайский порошок белого перца
  • 1 столовая ложка мелко нарезанного зеленого лука (зеленая часть)

Направление:

  1. Добавьте (A) в миску и аккуратно взбейте, чтобы перемешать.Не взбивайте яйца слишком сильно. Процедите смесь через мелкое сито.
  2. Смешайте свиной фарш с (B) и оставьте мариноваться не менее 10 минут.
  3. Нагрейте вок с маслом и обжарьте, помешивая, свиной фарш, пока он не станет готовым на поверхности (уже не розовый), разбивая его на более мелкие кусочки с помощью лопатки. Не пережаривайте.
  4. Выложите частично приготовленную свинину тонким слоем на широкую и неглубокую посуду. Полить свинину окрашенной яичной смесью. Сверху выложить нарезанную морковь. Если вы видите пузыри, «разгладьте» поверхность яичной смеси тыльной стороной ложки.
  5. Накройте форму прозрачной пищевой пленкой или алюминиевой фольгой.
  6. Готовьте яичный крем на сильном огне примерно 15 минут. Чтобы проверить, приготовлена ​​ли яичная смесь, вставьте в нее бамбуковую палочку: если вытечет немного прозрачной жидкости, значит, она приготовлена. Подавать с теплым рисом.
.

Смотрите также


Scroll to Top

Follow Us